|
|
||||||||
|
The Arabidopsis dw f 7/ste1 Mutant Is Defective in the
Sunghwa Choea,
Takahiro Noguchib,
Shozo Fujiokab,
Suguru Takatsutoc,
Christophe P. Tissiera,
Brian D. Gregorya,
Amanda S. Rossa,
Atsushi Tanakaa,d,
Shigeo Yoshidab,
Frans E. Taxa, and
Kenneth A. Feldmanna
|
|
|
ABSTRACT |
|---|
Lesions in brassinosteroid (BR) biosynthetic genes result in characteristic dwarf phenotypes in plants. Understanding the regulation of BR biosynthesis demands continued isolation and characterization of mutants corresponding to the genes involved in BR biosynthesis. Here, we present analysis of a novel BR biosynthetic locus, dwarf7 (dwf7). Feeding studies with BR biosynthetic intermediates and analysis of endogenous levels of BR and sterol biosynthetic intermediates indicate that the defective step in dwf7-1 resides before the production of 24-methylenecholesterol in the sterol biosynthetic pathway. Furthermore, results from feeding studies with 13C-labeled mevalonic acid and compactin show that the defective step is specifically the
7 sterol C-5 desaturation, suggesting that dwf7 is an allele of the previously cloned STEROL1 (STE1) gene. Sequencing of the STE1 locus in two dwf7 mutants revealed premature stop codons in the first (dwf7-2) and the third (dwf7-1) exons. Thus, the reduction of BRs in dwf7 is due to a shortage of substrate sterols and is the direct cause of the dwarf phenotype in dwf7.
|
|
INTRODUCTION |
|---|
Sterols are known to play at least two critical roles in plants: as bulk components of membranes regulating stability and permeability (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
|
In plants, sterols are subject to a series of modifications before conversion to BL. Different sterols, such as 24-methylenecholesterol (24-MC), campesterol (CR), isofucosterol, and sitosterol, are converted to the BL congeners dolicholide, BL, 28-homodolicholide, and 28-homoBL, respectively, in a species-specific manner (![]()
![]()
![]()
Several mutants, such as constitutive photomorphogenesis and dwarfism (cpd), deetiolated2 (det2), and dwarf4 (dwf4), have been shown to be defective in the BR-specific pathway (![]()
![]()
![]()
![]()
-hydroxylated compounds (![]()
![]()
![]()
-reductases. Like its animal equivalents, DET2 successfully converted progesterone (3-oxo-
4,5 steroid) to 4,5-dihydroprogesterone in a human cell line. In addition, the human 5
-reductase gene effectively complemented det2 mutants (![]()
![]()
-hydroxylation, is blocked in dwf4 mutants.
In the plant sterol biosynthetic pathway, several of the genes have been cloned or identified based on heterologous expression or sequence similarity. First, ![]()
![]()
![]()
![]()
-demethylation reaction, ![]()
-demethylase cytochrome P450 enzyme (CYP51) from Sorghum bicolor. Based on sequence similarity, ![]()
![]()
As compared with the wealth of cloned genes in sterol biosynthesis, only one mutant has been found in these genes. ![]()
7 sterol C-5 desaturase) in the ste1-1 mutant increased the level of C-5desaturated sterols 1.7- to 2.8-fold compared with the ste1-1 control, suggesting functional conservation of the enzymes from yeast and plants. However, visible phenotypes were not found in ste1-1 plants. Thus, the authors hypothesized that the residual 30% level of C-5desaturated sterols was sufficient for the growth of plants.
We have been characterizing a large collection of BR dwarf mutants. Of the eight dwf loci identified to date, dwf3 (cpd; ![]()
![]()
![]()
![]()
![]()
![]()
|
|
RESULTS |
|---|
Isolation of dwf7 Mutants
The dwf7-1 mutant originally was identified in a screen of 14,000 T-DNAtransformed lines of Arabidopsis. Genetic complementation tests with other dwf loci indicated that dwf7 belongs to a unique complementation group. dwf7-1 segregated as a monogenic recessive mutation; progeny from a heterozygote segregated 325 (wild type):98 (dwf7-1). Although dwf7-1 originated from a T-DNA mutant population, it failed to cosegregate with the kanamycin resistance marker in the T-DNA, suggesting that dwf7-1 was an untagged mutant. Furthermore, mapping the dwf7-1 mutation to the Arabidopsis genome by using simple sequence length polymorphisms (SSLPs; ![]()
A second allele of dwf7 was identified among 43 dwarf mutants isolated by screening >50,000 M2 seeds of an EMS mutant population. Similar to dwf7-1, the new allele was biochemically complemented by early BR biosynthetic intermediates, including 22
-hydroxycampesterol (22-OHCR) and cathasterone (data not shown), and mapped near nga172 (data not shown). Sequencing revealed a premature stop codon in exon 1 (see below).
Morphological Analysis of dwf7-1
dwf7 displays many of the characteristics of other BR dwarfs as shown in Figure 2. Compared with 1-month-old wild-type plants (Figure 2A), dwf7-1 plants grown for 5 weeks in the light possess short robust inflorescences, dark-green, round leaves, reduced fertility, and short pedicels and siliques (Figure 2C). The wild type generally terminates flowering before 7 weeks of age; however, dwf7-1 continues to produce flowers at this age, indicating a prolonged life span (Figure 2B). Additional morphological defects of 5-week-old light-grown plants are summarized in Table 1. Most noticeably, the height of dwf7-1 plants is strikingly reduced and is only 14% that of wild-type height. The leaf blade width of dwf7-1 mutants is similar to that of wild-type plants; however, the length is greatly reduced (1.8 cm) as compared with that of the wild type (3 cm), resulting in the round shape of dwf7-1 leaves. The overall morphology of dwf7-2 was similar to dwf7-1 except that it was slightly shorter and more sterile (data not shown).
|
|
Because null mutations in the BR pathway result in a dwarf phenotype, as well as defects in skotomorphogenesis, we compared the dwf7-1 mutant with other BR dwarfs for growth in the dark. Hypocotyl lengths from the longest to the shortest were 18 ± 1.6 (wild type; units in millimeters ±SE; n = 15), 6.3 ± 0.29 (dwf7-1), 4.1 ± 0.03 (det2/dwf6), 1.26 ± 0.09 (dwf4), 1.24 ± 0.08 (cpd/dwf3), and 1.18 ± 0.08 (bri1/dwf2). These data indicate that dwf7-1 displays a less severe phenotype (35% that of wild-type hypocotyl length) than do other BR dwarfs (e.g., 7% of wild type in dwf4; ![]()
Unlike severe dwarfs, such as dwf4 and cpd, dwf7-1 mutants are not mechanically sterile (Figure 2B). However, the average number of seeds in a silique is reduced in dwf7-1 (n = 12) compared with that of the wild type for reasons yet to be identified (n = 49) (Table 1). Scanning electron microscopy (Figure 3A to C) demonstrates a relationship between fertility and floral structure. In the wild type (Figure 3A), the length of stamens is greater than or similar to that of the gynoecium (quantified in Figure 3d), facilitating dehiscence of pollen on the stigmatic surface. Although dwf7-1 flowers (Figure 3B and Figure 3d) possess stamens and gynoecia that are shorter than those in the wild type, the fertility of dwf7-1 flowers is possible through a concomitant reduction in the length of both organs. In contrast, only stamen elongation is affected more severely in dwf4 flowers (Figure 3C and Figure 3d). The short stamen length in dwf4 is likely to cause dehiscence of pollen on the ovary wall rather than on the stigmatic surface. In fact, when dwf4 pollen is transferred to either wild-type or dwf7-1 stigmas, viable seeds are made.
|
The common denominator for the various phenotypes found in dwf7-1 mutants is a reduction in longitudinal growth, which could be due to either a reduced number of cells or a failure in cell elongation. Observations made with other BR dwarf mutants suggest that the number of cells is comparable in the wild type and mutants (![]()
![]()
![]()
|
We also have examined the organization of vascular bundles in wild-type and dwf7-1 mutants. Wild-type inflorescences possess eight vascular bundles (Figure 4D). However, the number of vascular bundles was reduced to six in dwf7-1 (Figure 4E). Furthermore, the spacing between the vascular bundles in dwf7-1 is irregular. In the wild type, interfascicular parenchyma cells alternate regularly with vascular bundles; however, cross-sections of dwf7-1 show that two vascular bundles are joined without being separated by parenchyma cells. Within a single vascular bundle, the size and number of xylem cells in dwf7-1 plants generally are reduced, whereas the number of phloem cells is similar to or even greater than that in the wild type. This characteristic abnormality of vascular bundle organization has been observed consistently in other BR dwarfs (![]()
Biochemical Complementation of dwf7-1 with BL
Figure 5 demonstrates that dwf7-1 seedlings grown in BL-supplemented liquid media were remarkably sensitive to BL. Growth in 1 nM BL induced significant elongation of dwf7-1 hypocotyls (160% increase), whereas the wild-type increase was marginal (5%). Treatment with 10 and 100 nM BL completely rescued dwf7-1 hypocotyls to wild-type length. The strongest response of the wild type to BL was obtained at 100 nM (Figure 5). Higher concentrations of BL (1 µM) caused a stressed morphology, including inhibition of root growth and swollen, twisted, and fragile hypocotyls in both dwf7-1 and wild-type plants (data not shown). After BL treatment of dwf7-1, cells in the treated region of the stem are similar in length to wild-type cells (Figure 4C).
|
Identification of the BR Biosynthetic Defect in dwf7-1
Biochemical complementation of dwf7-1 following application of BL suggested that dwf7-1 is likely to be defective in BR biosynthesis. To pinpoint the defective step in the BR biosynthetic pathway, dwf7-1 mutants were treated with BR biosynthetic intermediates. Due to undetectable bioactivity of some early intermediates (CR to 6-oxocampestanol) in bioassays (![]()
![]()
-hydroxylation reaction is reported to be mediated by DWF4 (![]()
Figure 6A shows the response when inflorescences were treated daily for 1 week with these BR intermediates. Complementing compounds induced growth of internodes and strongly increased pedicel length. dwf7-1 pedicels treated with 22-OHCR and BL showed growth greater than or equal to that of the wild type. Measurements of pedicel length shown in Figure 6B demonstrated that the three compounds tested, 22-OHCR, 6-deoxoCT, and BL, all increased dwf7-1 pedicel length >200% as compared with the control, suggesting that the defective step in BR biosynthesis is located at or before the CR biosynthetic step. Similarly, 3-week-old inflorescences of dwf7-2 were tested with 22-OHCR, 6-deoxoCT, teasterone, and BL. All four compounds induced significant elongation of pedicels and internodes (data not shown), indicating that dwf7-1 and dwf7-2 share the same biosynthetic defect.
|
As shown in Table 2, more definitive results indicating a specific defect in BR biosynthesis have been obtained from gas chromatographyselective ion monitoring (GC-SIM) analysis of endogenous BRs and sterols in dwf7-1 plants. The endogenous levels of sterols, such as 24-MC, CR, and campestanol (CN), in wild-type plants, were 3800, 32,900, and 1140 ng/g fresh weight, respectively. However, the levels of all three sterols in dwf7-1 mutants were extremely diminished at 3.1, 1.1, and 1.4% of the wild type, respectively, suggesting that the biosynthetic block is located before 24-MC. These data are consistent with the results of intermediate feeding studies (Figure 6).
|
Further biochemical feeding studies with 13C-labeled mev-alonic acid (MVA) and compactin, a MVA biosynthetic inhibitor, were performed to identify the specific sterol biosynthetic step defective in dwf7-1 plants. In a preliminary experiment, the effects of compactin and MVA on the growth of Arabidopsis seedlings in liquid media were investigated. The growth of wild-type Arabidopsis seedlings was almost completely inhibited in the presence of 10 µM compactin. The inhibition, however, was restored to the level of controls by the simultaneous application of 4.5 mM of MVA (data not shown). Therefore, 4.5 mM 13C-MVA and 10 µM compactin were added to Arabidopsis seedling cultures in the metabolic feeding studies. After 11 days in culture, sterols were extracted and purified by silica and octadecylsilane (ODS) cartridge columns and ODS-HPLC. Purified samples were derivatized and analyzed by gas chromatographymass spectrometry (GC-MS). As shown in Figure 7, 13C-MVA was converted to 13C5-episterol and subsequent sterols, such as 13C524-MC and 13C5-CR in the wild type. However, the 13C55-dehydroepisterol and downstream compounds were not detected in dwf7-1 mutants, whereas the precursor 13C5-episterol accumulated fourfold as compared with the wild type. In addition, an uncommon sterol, 13C57-dehydrocampestanol (24-epifungisterol), greatly accumulated (Figure 7). Two lines of evidencea failure to convert episterol to subsequent sterols, such as 24-MC and CR, and accumulation of 7-dehydrocampestanol in dwf7-1suggest that the defective step in dwf7-1 is the C-5 desaturation stop.
|
Molecular Characterization of dwf7
An EMS-induced mutant (ste1-1) of STE1 encoding a
7 sterol C-5 desaturase did not possess a dwarf phenotype (![]()
|
In addition to creating a stop codon, the mutation in dwf7-1 eliminated a HaeIII restriction enzyme recognition site (GGCC to AGCC). Taking advantage of this restriction enzyme site change, we tested the linkage of this mutation to the dwf7-1 phenotype. DNAs isolated from 17 different dwarf plants from a segregating F2 population were subjected to polymerase chain reaction (PCR) analysis by using S5D_3F and S5D_1R primers (underlines were used to distinguish forward or reverse primers from the gene acronym S5D), and the PCR products were digested with HaeIII. Agarose gel electrophoresis definitively showed that none of the PCR products from 17 mutant templates was restricted, whereas products from wild-type templates were all restricted at the HaeIII site (data not shown). These data suggest that the creation of the premature stop codon in exon 3 is the cause of the dwf7-1conferred phenotype.
To better understand the importance of these nonsense mutations, we analyzed the sequence of STE1 in relation to other C-5 desaturase proteins isolated from fungi. The STE1 protein is composed of 281 predicted amino acids with a theoretical pI of 6.39 and molecular mass of 33 kD. Whereas yeast ERG3 (38% identical; ![]()
![]()
![]()
|
|
|
DISCUSSION |
|---|
In this report, we present morphological, biochemical, and molecular analysis of Arabidopsis dwf7 mutants. Morphologically, dwf7-1 plants display a dramatic reduction in the length of many different organs examined, and this size reduction is attributable to a defect in cell elongation. Biochemically, dwf7-1 hypocotyls were converted completely to wild-type length with the application of BL, suggesting a deficiency in BRs. In agreement with this, BR intermediate feeding analysis, accompanied by analysis of endogenous levels of BRs and sterols by using GC-SIM, indicated that dwf7-1 is defective specifically in the
7 sterol C-5 desaturase step of the sterol biosynthetic pathway. Sequencing of the
7 sterol C-5 desaturase gene in dwf7-1 and dwf7-2 revealed premature stop codons, suggesting loss-of-function mutations. Thus, we propose that a shortage of sterols leads to a drastic reduction of BR levels in dwf7-1 and dwf7-2 and to the characteristic dwarf phenotype.
BRs Regulate Cell Elongation and Cell Differentiation
The overall morphology of plants is dependent on three factors: cell size, shape, and number (![]()
![]()
![]()
![]()
Apart from a reduction in cell elongation, a deficiency of endogenous BRs resulted in altered organization of vascular tissue in the inflorescence (Figure 4E). ![]()
![]()
![]()
![]()
Auxins also are known to be a major factor affecting differentiation of the vascular system (![]()
![]()
![]()
![]()
![]()
![]()
It needs to be pointed out that hypocotyl growth in darkness is accomplished through both GA- and BR-dependent cell elongation processes. One piece of evidence for dependence on both GA and BR is that dwf7-1 hypocotyls elongated fivefold in response to darkness as compared with light-grown hypocotyls (data not shown), although they are still shorter than those of the wild type. Because BL levels are not detectable in dwf7-1 plants (Table 2), growth of dwf7-1 in the dark could be accomplished mostly by GA-dependent cell elongation processes. ![]()
![]()
dwf7 Plants Are Defective in Sterol Biosynthesis Leading to BRs
A defect either in a biosynthetic enzyme or a factor modulating an enzymatic activity could lead to deficiency of endogenous BRs. To place dwf7 at a specific step in the proposed BR biosynthetic pathway, we first chose to perform feeding studies with BR biosynthetic intermediates. Rescue of dwf7-1 by exogenous application of 22-OHCR suggests that the biosynthetic defect likely resides before the production of CR (Figure 6A). Consistent with the results from feeding studies, the endogenous levels of 24-MC, CR, and CN were extremely reduced in dwf7-1 (Table 2). These data indicate that the biosynthetic defect is before 24-MC; dwf7-1 contains only 3% of 24-MC as compared with the wild type. When the phenotypes of dwf7-1 are compared with the downstream biosynthetic mutant dwf4 and the BR-insensitive bri1 (dwf2) mutant (![]()
![]()
Placing dwf7 at a single sterol biosynthetic step was accomplished through feeding studies with 13C-MVA and compactin. A greater than fourfold accumulation of episterol accompanying the absence of downstream intermediates in dwf7-1 indicates that the
7 sterol C-5 desaturase step is blocked in dwf7. In addition, the feeding studies identified an accumulation of 7-dehydrocampestanol, which is an uncommon sterol in plants (Figure 7). Accumulation of this compound only in dwf7-1 suggests that sterol biosynthesis in dwf7-1 could proceed to a C-24 reduction step, skipping C-5 desaturation as well as the next immediate C-7 reduction. The C-24 reductase seems to convert episterol independently of the immediate upstream enzyme. The absence of a detectable amount of C-7reduced compounds in dwf7-1 suggests that the enzymatic step is highly dependent on the C-5 desaturation reaction. This confirms the sequence of reactions originally proposed by ![]()
![]()
dwf7 Mutants Produce Nonfunctional
7 Sterol C-5 Desaturase Due to Premature Stop Codons
The
7 sterol C-5 desaturasemediated reaction is common to both photosynthetic and nonphotosynthetic organisms. Many genes encoding a C-5 desaturase have been cloned from fungi. First, ![]()
7 sterols, were restored to wild-type phenotype when transformed with a wild-type genomic clone of the
7 sterol C-5 desaturase gene. ![]()
![]()
-sterol-demethylase) from C. glabrata. The authors found that lethal erg11 mutations can be suppressed by an additional mutation in erg3. They reasoned that formation of toxic 3ß,6
-diol sterols in erg11 mutants is prevented due to the defect in C-5 desaturation in erg11 erg3 double mutants.
In plants, ![]()
![]()
![]()
Closely spaced histidine residues, HX3H in
helices, serve as typical metal binding motifs in many proteins (![]()
![]()
9 desaturase failed to complement the yeast mutant ole1, which is defective in the same enzymatic step, suggesting that the individual histidine residues are essential for the function of the enzyme. On the basis of these observations, ![]()
![]()
![]()
7 sterol C-5 desaturases.
More direct evidence of metal ion involvement in
7 sterol C-5 desaturase function was obtained by ![]()
![]()
![]()
![]()
|
|
METHODS |
|---|
Plant Growth
For sterile growth of Arabidopsis thaliana plants, seeds of mutants and the wild type were sterilized (50% Clorox and 0.005% Triton X-100) for 8 min, washed three times with sterile distilled water, and dried with 95% ethanol. The seeds were sprinkled on 0.8% agar-solidified media or in liquid media containing 1 x ![]()
Morphometric and Physiological Analysis
At 5 weeks of age, the various morphological traits listed in Table 1 were measured. The number of seeds per silique was determined after the plants were completely dried. Unopened siliques from each plant were selected and crushed, and the number of seeds was counted under a dissecting microscope. To measure the fresh and dry weight, we cut the aerial parts of the plants and immediately weighed them to obtain the fresh weight; the plants were then completely dried in a 60°C oven for 5 days before measuring the dry weight. Observations on the structure of flowers were made with flowers at stage 14 (![]()
The anatomical studies using a scanning electronic microscope and a light microscope were performed as described by ![]()
Mapping and Sequencing of the DWARF7 Locus
The mapping of dwarf7 (dwf7) was performed using simple sequence length polymorphism (SSLP) markers (![]()
![]()
![]()
PCR products amplified using primer sets derived from the cDNA sequence of STEROL1 (STE1) were subjected to sequencing. To design sets of primers that do not fall in exonintron junctions, we predicted possible splice sites by using the RNASPL program available at the Internet site of Baylor College of Medicine (Houston, TX; http://dot.imgen.bcm.tmc.edu:9331/seq-search/gene-search.html). Primers were designed using the Primer Selection software of DNAstar (DNASTAR Inc., Madison, WI). Oligonucleotide sequences 5' to 3' are CAGTGTGAGTAAT T TAGCAT TACTA (S5D_FF), GGAAAGATCATC-AAACAT T TACATGT (S5D_LR), GCGCAATCT TCT T TCGT T T (S5D_1F), TGGACAACAACAACACAAGA (S5D_1R), GATGCACAGAGAGCT- TCATGAC (S5D_2F), CCGGCAAATGGAGAGAGTGTAT (S5D_2R), CACCCATCATATCTACAACAA (S5D_3F), and CATCT T T TGCCG-GCGAATCTAT (S5D_4F) (underlines were added to distinguish forward or reverse primers from the gene acronym S5D). Primers were purchased from Genosys Biotechnologies, Inc. (The Woodlands, TX). For template DNA, genomic DNA was isolated from two or three leaves of dwf7-1 and wild-type plants according to the method described by ![]()
Standard PCR reaction mixtures, 1 x PCR buffer (10 mM Tris-HCl, 1.5 mM MgCl2, and 50 mM KCl, pH 8.3), 0.2 µM each of forward and reverse primer, 0.2 mM each deoxynucleotide triphosphates, 1 ng of genomic DNA, and 2 units of Taq polymerase were subjected to a PCR program consisting of an initial denaturation at 95°C for 2 min and then for 35 cycles (95°C for 30 sec, 56°C for 30 sec, and 72°C for 2.5 min ), with a final elongation step of 7 min at 72°C. PCR-amplified DNA was size-separated on 0.8% agarose gels in 1 x TAE, and the resulting DNA bands were gel-purified using a DNA purification kit (Bio-Rad). The concentration of the extracted DNA was measured by comparing the band intensity with a DNA mass standard (Bethesda Research Laboratories). Sequencing of the DNA was performed at the Arizona Research Laboratory (University of Arizona, Tucson). DNA sequence analysis was conducted using software packages, including one from Genetics Computer Group (Madison, WI) and other database search tools available on the Internet.
The base change in dwf7-1 eliminated the recognition site for a restriction enzyme HaeIII by converting the sequence from GGCC to AGCC. Thus, we utilized this polymorphism to test the cosegregation of the dwarf phenotype with the mutation. The 0.8 kb of DNA spanning the mutation was amplified using S5D_3F and S5D_1R primers from 17 different dwarf plants from the mapping lines. Two microliters from each 20 µL of PCR-amplified DNA was digested with the restriction enzyme HaeIII (Boehringer Mannheim). After complete digestion, the samples were resolved on a 2% agarose gel in 1 x TAE buffer.
Genomic DNA sequence flanking the cDNA was identified by sequencing the products obtained from thermal asymmetric interlaced PCR (TAIL PCR) (![]()
![]()
![]()
![]()
Feeding Experiments
Biochemical complementation of dwf7-1 plants with different concentrations of brassinolide (BL) was performed in liquid media. BL-supplemented (control, 10-9, 10-8, and 10-7 M) sterile liquid media (1.5 mL) was dispensed into wells of a 24-well plate (Corning Co., Corning, NY). Three seedlings, germinated on agar-solidified media, were transferred into each well. After a week of growth with continuous shaking (230 rpm), the seedlings were lightly stained with toluidine blue, and hypocotyls and roots were measured to the nearest millimeter.
Feeding experiments using biosynthetic intermediates were performed with 3-week-old mutant plants. The intermediates tested were diluted to the desired concentration with water containing 0.01% Tween 20. Two microliters of each brassinosteroid (BR) solution was applied daily to the shoot tips of plants by using a micro pipettman. After 1 week of treatment, total growth of inflorescence and pedicels was measured to the nearest millimeter (n = 15).
Analysis of Endogenous BRs
Plants were grown for 5 weeks on soil. Two hundred grams of the aerial parts of plants, including stems, flowers, leaves, and siliques, was harvested and subjected to BR extraction. The procedure for extraction and analysis of BR intermediates by using GC-SIM has been described (![]()
13C-Labeled Mevalonic Acid Feeding Experiments
Before feeding experiments, seedlings were germinated and grown on 0.5 x Murashige and Skoog agar medium in the light at 22°C (25 mL per dish). Eight days after sowing, the seedlings were transferred to a 200-mL flask containing 30 mL of Murashige and Skoog media supplemented with 3% sucrose (Ws-2, five seedlings; dwf7-1, 40 seedlings).
Compactin (mevastatin; Sigma) was converted to its sodium salt as described previously (![]()
Each fraction was converted to a trimethylsilyl derivative and analyzed by gas chromatographymass spectrometry (GC-MS). GC-MS analyses were performed on a JEOL Automass JMS-AM 150 mass spectrometer (Tokyo, Japan) connected to a Hewlett-Packard 5890A-II gas chromatograph with a capillary column DB-5 (0.25 mm x 15 m; 0.25-µm film thickness). The analytical conditions were the same as previously described (![]()
5-Dehydroepisterol, episterol, and 7-dehydrocampestanol were chemically synthesized (S. Takatsuto, C. Gotoh, T. Noguchi, and S. Fujioka, unpublished data).
|
|
ACKNOWLEDGMENTS |
|---|
We thank Brian P. Dilkes, Alice Traut, and Xuelu Wang for their technical assistance. We thank Pierre Benveniste and his collaborators for sharing unpublished data on ste1-1. S.C. thanks the Korean government for support as an overseas scholar (Grant No. 93-0019). A.T. thanks the JAERI and Science and Technology Agency of Japan. We also thank the staffs of the sequencing and imaging facilities in the Arizona Research Laboratory at the University of Arizona (Tucson). S.F. acknowledges support from RIKEN (President's Special Research Grant) and from a grant-in-aid for scientific research (B) from the Ministry of Education, Science, Sports, and Culture of Japan (Grant No. 10460050). K.A.F. acknowledges support from the National Science Foundation (Grant No. 9604439).
Received November 11, 1998; accepted November 18, 1998.
|
|
REFERENCES |
|---|
Aarts, M.G.M., Keijzer, C.J., Stiekema, W.J., and Pereira, A. (1995) Molecular characterization of the CER1 gene of Arabidopsis involved in epicuticular wax biosynthesis and pollen fertility. Plant Cell 7:2115-2127[Abstract].
Aloni, R. (1987) Differentiation of vascular tissue. Annu. Rev. Plant Physiol. 38:179-204[CrossRef][ISI].
Arthington, B.A., Hoskins, J., Skatrud, P.L., and Bard, M. (1991) Nucleotide sequence of the gene encoding yeast C-8 sterol isomerase. Gene 107:173-174[CrossRef][ISI][Medline].
Azpiroz, R., Wu, Y., LoCascio, J.C., and Feldmann, K.A. (1998) An Arabidopsis brassinosteroid-dependent mutant is blocked in cell elongation. Plant Cell 10:219-230
Bach, T.J., and Benveniste, P. (1997) Cloning of cDNAs or genes encoding enzymes of sterol biosynthesis from plants and other eukaryotes: Heterologous expression and complementation analysis of mutations for functional characterization. Prog. Lipid Res. 36:197-226[CrossRef][Medline].
Bak, S., Kahn, R.A., Olsen, C.E., and Halkier, B.A. (1997) Cloning and expression in Escherichia coli of the obtusifoliol 14-
-demethylase of Sorghum bicolor (L.) Moench, a cytochrome P450 orthologous to the sterol 14-
-demethylases (CYP51) from fungi and mammals. Plant J. 11:191-201[CrossRef][ISI][Medline].
Barton, G.J. (1993) ALSCRIPT, a tool to format multiple sequence alignments. Protein Eng. 6:37-40
Bell, C.J., and Ecker, J.R. (1994) Assignment of 30 microsatellite loci to the linkage map of Arabidopsis. Genomics 19:137-144[CrossRef][ISI][Medline].
Benveniste, P. (1986) Sterol biosynthesis. Annu. Rev. Plant Physiol. 37:275-308[CrossRef].
Bouvier-Navè, P., Husselstein, T., Desprez, T., and Benveniste, P. (1997) Identification of cDNAs encoding sterol methyl-transferases involved in the second methylation step of plant sterol biosynthesis. Eur. J. Biochem. 246:518-529[Medline].
Choe, S., Dilkes, B.P., Fujioka, S., Takatsuto, S., Sakurai, A., and Feldmann, K.A. (1998) The DWF4 gene of Arabidopsis encodes a cytochrome P450 that mediates multiple 22
-hydroxylation steps in brassinosteroid biosynthesis. Plant Cell 10:231-243
Choi, Y.H., Fujioka, S., Nomura, T., Harada, A., Yokota, T., Takatsuto, S., and Sakurai, A. (1997) An alternative brassinolide biosynthetic pathway via late C-6 oxidation. Phytochemistry 44:609-613[CrossRef].
Clouse, S.D., and Zurek, D. (1991). Molecular analysis of brassinolide action in plant growth and development. In Brassinosteroids: Chemistry, Bioactivity and Applications, H.G. Cutler, T. Yokota, and G. Adam, eds (Washington DC: American Chemical Society), pp. 122140.
Clouse, S.D., Langford, M., and McMorris, T.C. (1996) A brassinosteroid-insensitive mutant in Arabidopsis thaliana exhibits multiple defects in growth and development. Plant Physiol. 111:671-678[Abstract].
Corey, E.J., Matsuda, S.P.T., and Bartel, B. (1993) Isolation of an Arabidopsis thaliana gene encoding cycloartenol synthase by functional expression in a yeast mutant lacking lanosterol synthase by the use of a chromatographic screen. Proc. Natl. Acad. Sci. USA 90:11628-11632
Cosgrove, D.J. (1997) Relaxation in a high-stress environment: The molecular bases of extensible cell walls and cell enlargement. Plant Cell 9:1031-1041[CrossRef][ISI][Medline].
Dellaporta, S.L., Wood, J., and Hicks, J.B. (1983) A plant DNA minipreparation: Version II. Plant Mol. Biol. Rep. 1:19-21